Skip to main content

pLEXm-hCD45d
(Plasmid #247052)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247052 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLEXm
  • Backbone manufacturer
    First described in A.R. Aricescu et al. Acta Crystallogr D Biol Crystallogr. (2006)
  • Backbone size w/o insert (bp) 4506
  • Total vector size (bp) 6267
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hCD45d1d2-MBP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1761
  • Mutation
    Domains 1 and 2 only, corresponding to residues 223-392 of UniProtKB accession number P08575
  • Promoter chick β-actin promoter
  • Tags / Fusion Proteins
    • Maltose binding protein (MBP) (C terminal on insert)
    • His6 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer pLEX-1679F (CAACGTGCTGGTTGTTGTGCTG)
  • 3′ sequencing primer pLEX-1843R (ACCACCTTCTGATAGGCAGCCT)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Original pLEXm-CD45d1d2 was a kind gift from Simon Davis and previously described in Chang et al., 2016 (https://doi.org/10.1038/ni.3392)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEXm-hCD45d was a gift from Omer Dushek (Addgene plasmid # 247052 ; http://n2t.net/addgene:247052 ; RRID:Addgene_247052)
  • For your References section:

    NanoBondy Reaction through NeissLock Anhydride Allows Covalent Immune Cell Decoration. Vankayala LR, Adoni KR, Lim SYT, Dam T, Dushek O, Thalassinos K, Howarth MR. Bioconjug Chem. 2026 Feb 18;37(2):281-292. doi: 10.1021/acs.bioconjchem.5c00519. Epub 2026 Jan 24. 10.1021/acs.bioconjchem.5c00519 PubMed 41578972
Commonly requested with: