pCS-APTA
(Plasmid
#247077)
-
PurposepCS27 containing aroL, ppsA, tktA, aroG(fbr) from E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247077 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePCS-27
- Backbone size w/o insert (bp) 2254
- Total vector size (bp) 8190
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namearoL
-
SpeciesE.coli
-
Insert Size (bp)522
- Promoter PLlacO1
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (unknown if destroyed)
- 3′ cloning site Nde1 (unknown if destroyed)
- 5′ sequencing primer gggaaaggtaccatgacacaacctctttttctgatcgggc
- 3′ sequencing primer gggaaacatatgtcaacaattgatcgtctgtgccagggc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameppsA
-
SpeciesE.coli
-
Insert Size (bp)2376
- Promoter PLlacO1
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Nde1 (unknown if destroyed)
- 3′ cloning site Sal1 (unknown if destroyed)
- 5′ sequencing primer gggaaacatatgaggagatataccatgtccaacaatggctcgtcac
- 3′ sequencing primer gggaaagtcgacttatttcttcagttcagccaggcttaac
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nametktA
-
SpeciesE.coli
-
Insert Size (bp)1989
- Promoter PLlacO1
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (unknown if destroyed)
- 3′ cloning site Sph1 (unknown if destroyed)
- 5′ sequencing primer gggaaactcgagaggagatataccatgtcctcacgtaaagagcttgcc
- 3′ sequencing primer gggaaagcatgcttacagcagttcttttgctttcgcaac
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namearoG(fbr)
-
SpeciesE.coli
-
Insert Size (bp)1048
-
Mutationfeedback-inhibition-resistant
- Promoter PLlacO1
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site Sph1 (unknown if destroyed)
- 3′ cloning site Hind3 (unknown if destroyed)
- 5′ sequencing primer gggaaagcatgcaggagatataccatgaattatcagaacgacgatttacgc
- 3′ sequencing primer gggaaaaagcttttacccgcgacgcgcttttac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS-APTA was a gift from Yajun Yan (Addgene plasmid # 247077 ; http://n2t.net/addgene:247077 ; RRID:Addgene_247077) -
For your References section:
High-level De novo biosynthesis of arbutin in engineered Escherichia coli. Shen X, Wang J, Wang J, Chen Z, Yuan Q, Yan Y. Metab Eng. 2017 Jul;42:52-58. doi: 10.1016/j.ymben.2017.06.001. Epub 2017 Jun 2. 10.1016/j.ymben.2017.06.001 PubMed 28583673