pcDNA3.1/Puro-CAG-JEDI-2Psub
(Plasmid
#247186)
-
PurposeGenetically encoded voltage indicator (GEVI) JEDI-2Psub expressed under strong mammalian promoter (CAG)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1/Puro-CAG
- Backbone size w/o insert (bp) 6104
- Total vector size (bp) 7382
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJEDI-2Psub
-
Alt nameJEDI2Psub
-
SpeciesSynthetic
-
Insert Size (bp)1284
-
GenBank IDPX400569
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was only used for in vitro characterization and was not tested in vivo in the corresponding publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/Puro-CAG-JEDI-2Psub was a gift from Francois St-Pierre (Addgene plasmid # 247186 ; http://n2t.net/addgene:247186 ; RRID:Addgene_247186) -
For your References section:
All-optical voltage interrogation for probing synaptic plasticity in vivo. Carolan J, Land MA, Lu X, Beau M, Kostadinov D, St-Pierre F, Clark BA, Hausser M. Nat Commun. 2025 Oct 3;16(1):8834. doi: 10.1038/s41467-025-63867-4. 10.1038/s41467-025-63867-4 PubMed 41044179