DHFR-TEV (integrating)
(Plasmid
#247218)
-
PurposePlasmid for genomic integration of DHFR-TEV into the YORWΔ22 locus of yeast cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCustom backbone constructed with the MoClo yeast toolkit (YTK)
-
Backbone manufacturerJohn Dueber, Addgene kit #1000000061
- Total vector size (bp) 7232
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDHFR-TEV
- Promoter TEF2
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer ctacttgtttattcccttcaagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Linearize with NotI before transformation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DHFR-TEV (integrating) was a gift from Johannes Herrmann (Addgene plasmid # 247218 ; http://n2t.net/addgene:247218 ; RRID:Addgene_247218) -
For your References section:
The IQ-compete assay for measuring mitochondrial protein import efficiencies in living yeast cells. Hoffman Y, Egeler A, Rodl S, Herrmann JM. FEBS Lett. 2025 Oct 25. doi: 10.1002/1873-3468.70206. 10.1002/1873-3468.70206 PubMed 41137490