Skip to main content

pAAV-CaMKIIa-JEDI-2Psub-Kv-WPRE
(Plasmid #247223)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247223 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-CaMKIIa
  • Backbone size w/o insert (bp) 5364
  • Total vector size (bp) 6876
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    JEDI-2Psub-Kv
  • Alt name
    JEDI2Psub
  • Alt name
    JEDI-2Psub
  • Alt name
    JEDI2Psub-Kv
  • Species
    Synthetic
  • Insert Size (bp)
    1512
  • GenBank ID
    PX400569
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • Kv (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCTGACGAAGGCTCGCGA
  • 3′ sequencing primer caaaggcattaaagcagcgtatc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was packaged into an AAV and tested in vivo in the corresponding publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-JEDI-2Psub-Kv-WPRE was a gift from Francois St-Pierre (Addgene plasmid # 247223 ; http://n2t.net/addgene:247223 ; RRID:Addgene_247223)
  • For your References section:

    All-optical voltage interrogation for probing synaptic plasticity in vivo. Carolan J, Land MA, Lu X, Beau M, Kostadinov D, St-Pierre F, Clark BA, Hausser M. Nat Commun. 2025 Oct 3;16(1):8834. doi: 10.1038/s41467-025-63867-4. 10.1038/s41467-025-63867-4 PubMed 41044179