pAAV-EF1a-DIO-JEDI-2Psub-WPRE
(Plasmid
#247224)
-
PurposeDouble floxed genetically encoded voltage indicator (GEVI) JEDI-2Psub in AAV production vector under the control of the mammalian promoter (EF1a)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-EF1a-DIO
- Backbone size w/o insert (bp) 5617
- Total vector size (bp) 6901
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameJEDI-2Psub
-
Alt nameJEDI2Psub
-
SpeciesSynthetic
-
Insert Size (bp)1284
-
GenBank IDPX400569
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bsp1407I (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GGTTGATTATCGATAAGCTTGATATCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was not directly tested in the corresponding publication, but the plasmid does contain the GEVI characterized in the corresponding publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-DIO-JEDI-2Psub-WPRE was a gift from Francois St-Pierre (Addgene plasmid # 247224 ; http://n2t.net/addgene:247224 ; RRID:Addgene_247224) -
For your References section:
All-optical voltage interrogation for probing synaptic plasticity in vivo. Carolan J, Land MA, Lu X, Beau M, Kostadinov D, St-Pierre F, Clark BA, Hausser M. Nat Commun. 2025 Oct 3;16(1):8834. doi: 10.1038/s41467-025-63867-4. 10.1038/s41467-025-63867-4 PubMed 41044179