pAAV-EF1a-DIO-JEDI-2Psub-WPRE
(Plasmid #247224)

• Purpose: Double floxed genetically encoded voltage indicator (GEVI) JEDI-2Psub in AAV production vector under the control of the mammalian promoter (EF1a)
• Depositing Lab: Francois St-Pierre
• Publication: Carolan et al Nat Commun. 2025 Oct 3;16(1):8834. doi: 10.1038/s41467-025-63867-4.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-EF1a-DIO
• Backbone size w/o insert (bp): 5617
• Total vector size (bp): 6901
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: JEDI-2Psub
• Alt name: JEDI2Psub
• Species: Synthetic
• Insert Size (bp): 1284
• GenBank ID: PX400569
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bsp1407I (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: GGTTGATTATCGATAAGCTTGATATCG

Resource Information

• Supplemental Documents:
  • paav-ef1a-dio-jedi-2psub-wpre.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was not directly tested in the corresponding publication, but the plasmid does contain the GEVI characterized in the corresponding publication.