ICBE
(Plasmid
#247331)
-
PurposeVector encoding human codon-optimized engineered DelIscB nickase fusion with APOBEC3A and UGI driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247331 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneenIscB
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepCAG_enDelIscB(D60A)-hAPOBEC3A(W98Y/W104A/Y130F)-2×UGI_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gctgagcaagaggtaagggt
- 3′ sequencing primer ACCGTAAGTTATGTAACGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ICBE was a gift from Yong Tian (Addgene plasmid # 247331 ; http://n2t.net/addgene:247331 ; RRID:Addgene_247331)