Skip to main content

KLF17-CRa1-Lsg-MS2
(Plasmid #247476)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247476 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LsgRNA-MS2
  • Backbone manufacturer
    Ting Zhou, Addgene plasmid #235597
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA1 targeting KLF17 promoter
  • gRNA/shRNA sequence
    CCCTCACCATGCCCCAACCA
  • Species
    H. sapiens (human), Synthetic
  • Entrez Gene
    KLF17 (a.k.a. ZLF393, ZNF393, Zfp393)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KLF17-CRa1-Lsg-MS2 was a gift from Ting Zhou (Addgene plasmid # 247476 ; http://n2t.net/addgene:247476 ; RRID:Addgene_247476)
  • For your References section:

    Leveraging CRISPR activation for rapid assessment of gene editing products in human pluripotent stem cells. Wu Y, Zhong A, Evangelisti A, Sidharta M, Danwei H, Studer L, Zhou T. Stem Cell Reports. 2025 Apr 25:102499. doi: 10.1016/j.stemcr.2025.102499. 10.1016/j.stemcr.2025.102499 PubMed 40345204