Skip to main content

pX330_H1.0
(Plasmid #247482)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247482 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Feng Zhang lab (Addgene plasmid # 42230)
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H1.0 (H1F0)
  • Alt name
    sgRNA targeting human H1.0 (H1F0)
  • gRNA/shRNA sequence
    CACCGAGCAAAGTCCAGTGCCAAGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    H1-0 (a.k.a. H1.0, H10, H1F0, H1FV)
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.03.05.641622 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330_H1.0 was a gift from Kazuhiro Maeshima (Addgene plasmid # 247482 ; http://n2t.net/addgene:247482 ; RRID:Addgene_247482)
  • For your References section:

    Linker histone H1 functions as a liquid-like glue to organize chromatin in living human cells. Shimazoe MA, Huertas J, Phillips C, Ide S, Tamura S, Farr S, Ashwin SS, Sasai M, Collepardo-Guevara R, Maeshima K. Sci Adv. 2026 Apr 10;12(15):eaec9801. doi: 10.1126/sciadv.aec9801. Epub 2026 Apr 8. 10.1126/sciadv.aec9801 PubMed 41950317