psiCHECK-2 SV40 Cyclone-RLuc
(Plasmid #247494)

• Purpose: Acyclovir-regulated Renilla luciferase
• Depositing Lab: Samie Jaffrey
• Publication: Hou et al Nat Methods. 2025 Nov 3. doi: 10.1038/s41592-025-02860-7.

Backbone

• Vector backbone: psiCHECK-2
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5337
• Total vector size (bp): 7049
• Modifications to backbone: None
• Vector type: Mammalian Expression, Luciferase, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Renilla luciferase gene with Cyclone insertion
• Alt name: Cyclone-RLuc
• Species: Synthetic
• Insert Size (bp): 1712
• Mutation: Cyclone was inserted after Q288 of Renilla luciferase to gain acyclovir control.
• Promoter: SV40

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AACTTAAGCTGCAGAAGTTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: This plasmid contains a 64bp insertion in the backbone likely due to an error during the Gibson assembly ligation step. This insertion does not impact plasmid function.