LentiGuide Cyclone-Puro P2A EGFP
(Plasmid
#247497)
-
PurposeAcyclovir-regulated puromycin n-acetyltransferase-P2A-EGFP fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247497 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiGuide Puro-P2A-EGFP (Plasmid #137729)
-
Backbone manufacturerAddgene
- Total vector size (bp) 11739
-
Modifications to backboneNone
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepuromycin n-acetyltransferase with Cyclone insertion
-
Alt nameCyclone-Puro
-
SpeciesSynthetic
-
Insert Size (bp)1373
-
MutationCyclone was inserted after Glutamine135 of puromycin n-acetyltransferase to gain acyclovir control of the fusion protein.
- Promoter EF-1a
-
Tag
/ Fusion Protein
- Puro(Cyclone)-P2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttcaggtgtcgtgacgtacgg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiGuide Cyclone-Puro P2A EGFP was a gift from Samie Jaffrey (Addgene plasmid # 247497 ; http://n2t.net/addgene:247497 ; RRID:Addgene_247497) -
For your References section:
A portable poison exon for small-molecule control of mammalian gene expression. Hou Q, Oleynikov M, Mei X, Dong L, Hagen T, Jaffrey SR. Nat Methods. 2025 Nov 3. doi: 10.1038/s41592-025-02860-7. 10.1038/s41592-025-02860-7 PubMed 41184552