pCGT002_nuclear-EGFP
(Plasmid
#248084)
-
PurposeConstitutive expression of NLS-tagged EGFP from EF1-alpha promoter (for lentiviral packaging)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX_313-EGFP
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 8800
- Total vector size (bp) 9800
-
Modifications to backboneRemoved CAAX box and DD (degron tag), added 2x NLS at N and C termini of fluorophore.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)712
-
GenBank IDAFA52654.1
- Promoter EF1-alpha
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gggggaggggttttatgcgatgg
- 3′ sequencing primer acaacgggccacaactcctcataa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.06.27.661951 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCGT002_nuclear-EGFP was a gift from Arjun Raj (Addgene plasmid # 248084 ; http://n2t.net/addgene:248084 ; RRID:Addgene_248084) -
For your References section:
Lineage memory shapes viral resistance barriers in human skin. Van Eyndhoven LC, Kinsler G, Zhang J, O'Farrell A, Abderrahim R, Srivastav A, Triandafillou CG, Greco TM, Zaret KS, Cristea IM, Orzalli MH, Drayman N, Singh A, Raj A. bioRxiv [Preprint]. 2025 Jun 27:2025.06.27.661951. doi: 10.1101/2025.06.27.661951. 10.1101/2025.06.27.661951 PubMed 40666908