AAV-tsC2Pro-GFP
(Plasmid
#248521)
-
PurposeThis vector expresses Green Fluorescent Protein under the control of the Tree Shrew Cerebellin 2 Promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneMammalian Gene Expression AAV Vector
-
Backbone manufacturerVectorBuilder
- Backbone size w/o insert (bp) 3733
- Total vector size (bp) 6345
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTree Shrew Cerebellin 2 Promoter + Enhanced Green Fluorescent Protein
-
SpeciesTupaia Belangeri (Tree Shrew, tsC2Pro); Aequorea Victoria (Jellyfish, EGFP)
-
Insert Size (bp)2612
- Promoter Tree Shrew Cerebellin 2 Promoter (tsC2Pro)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer caactttgtatagaaaagttg
- 3′ sequencing primer cccactttgtacaagaaagctgggt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://dx.doi.org/10.2139/ssrn.5390881 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-tsC2Pro-GFP was a gift from Alev Erisir (Addgene plasmid # 248521 ; http://n2t.net/addgene:248521 ; RRID:Addgene_248521) -
For your References section:
CBLN2 promoter enables genetic access to wide-field neurons of the tree shrew superior colliculus. Kipcak A, Erisir A. Cell Rep Methods. 2026 Mar 23;6(3):101309. doi: 10.1016/j.crmeth.2026.101309. Epub 2026 Mar 6. 10.1016/j.crmeth.2026.101309 PubMed 41794023