Skip to main content

AAV-tsC2ProT-mScarlet3-Cre
(Plasmid #248522)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248522 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    Mammalian Gene Expression AAV Vector
  • Backbone manufacturer
    VectorBuilder
  • Backbone size w/o insert (bp) 3733
  • Total vector size (bp) 6345
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Truncated Tree Shrew Cerebellin 2 Promoter + mScarlet3 + Cre
  • Species
    Synthetic; Tupaia Belangeri (Tree Shrew, tsC2ProT); (mScarlet3), P1 Bacteriophage (Cre)
  • Insert Size (bp)
    3042
  • Promoter Truncated Tree shrew Cerebellin 2 Promoter

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer caactttgtatagaaaagttg
  • 3′ sequencing primer cccactttgtacaagaaagctgggt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://dx.doi.org/10.2139/ssrn.5390881 for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-tsC2ProT-mScarlet3-Cre was a gift from Alev Erisir (Addgene plasmid # 248522 ; http://n2t.net/addgene:248522 ; RRID:Addgene_248522)
  • For your References section:

    CBLN2 promoter enables genetic access to wide-field neurons of the tree shrew superior colliculus. Kipcak A, Erisir A. Cell Rep Methods. 2026 Mar 23;6(3):101309. doi: 10.1016/j.crmeth.2026.101309. Epub 2026 Mar 6. 10.1016/j.crmeth.2026.101309 PubMed 41794023