pEGFP-MeCP2-R255X (pc4749)
(Plasmid
#248578)
-
PurposeMammalian expression plasmid of MeCP2-R255X (aa1- aa254)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248578 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5192
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMeCP2
-
SpeciesH. sapiens (human)
-
Mutationaa1-aa254
-
Entrez GeneMECP2 (a.k.a. AUTSX3, MRX16, MRX79, MRXS13, MRXSL, PPMX, RS, RTS, RTT)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-MeCP2-R255X (pc4749) was a gift from Cristina Cardoso (Addgene plasmid # 248578 ; http://n2t.net/addgene:248578 ; RRID:Addgene_248578) -
For your References section:
MeCP2-induced heterochromatin organization is driven by oligomerization-based liquid-liquid phase separation and restricted by DNA methylation. Zhang H, Romero H, Schmidt A, Gagova K, Qin W, Bertulat B, Lehmkuhl A, Milden M, Eck M, Meckel T, Leonhardt H, Cardoso MC. Nucleus. 2022 Dec;13(1):1-34. doi: 10.1080/19491034.2021.2024691. 10.1080/19491034.2021.2024691 PubMed 35156529