Skip to main content

pSTTa-GNAO1
(Plasmid #248652)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248652 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSTTa (from pGEX)
  • Backbone manufacturer
    GE Healthcare
  • Backbone size w/o insert (bp) 4523
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GNAO1
  • Alt name
    G_o
  • Alt name
    ENSG00000087258
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1065
  • Entrez Gene
    GNAO1 (a.k.a. DEE17, EIEE17, G-ALPHA-o, GNAO, HG1G, HLA-DQB1, NEDIM)
  • Promoter tac
  • Tag / Fusion Protein
    • 2x StrepII, Thrombin site, TEV site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (destroyed during cloning)
  • 3′ cloning site PmlI (destroyed during cloning)
  • 5′ sequencing primer GEXtac (CAAATATTCTGAAATGAGCTGTTGACAA)
  • 3′ sequencing primer pGEX 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Genscript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSTTa-GNAO1 was a gift from Sarah Assmann (Addgene plasmid # 248652 ; http://n2t.net/addgene:248652 ; RRID:Addgene_248652)
  • For your References section:

    Influence of expression and purification protocols on Galpha biochemical activity: kinetics of plant and mammalian G protein cycles. Gookin TE, Chakravorty D, Assmann SM. Front Mol Biosci. 2025 Apr 7;12:1513660. doi: 10.3389/fmolb.2025.1513660. eCollection 2025. 10.3389/fmolb.2025.1513660 PubMed 40260404