pSTTa-GNAO1
(Plasmid
#248652)
-
PurposeVector for protein expression of 2x StrepII-tagged human heterotrimeric G protein GNAO1 in E. coli.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSTTa (from pGEX)
-
Backbone manufacturerGE Healthcare
- Backbone size w/o insert (bp) 4523
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGNAO1
-
Alt nameG_o
-
Alt nameENSG00000087258
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1065
-
Entrez GeneGNAO1 (a.k.a. DEE17, EIEE17, G-ALPHA-o, GNAO, HG1G, HLA-DQB1, NEDIM)
- Promoter tac
-
Tag
/ Fusion Protein
- 2x StrepII, Thrombin site, TEV site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (destroyed during cloning)
- 3′ cloning site PmlI (destroyed during cloning)
- 5′ sequencing primer GEXtac (CAAATATTCTGAAATGAGCTGTTGACAA)
- 3′ sequencing primer pGEX 3'
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSTTa-GNAO1 was a gift from Sarah Assmann (Addgene plasmid # 248652 ; http://n2t.net/addgene:248652 ; RRID:Addgene_248652) -
For your References section:
Influence of expression and purification protocols on Galpha biochemical activity: kinetics of plant and mammalian G protein cycles. Gookin TE, Chakravorty D, Assmann SM. Front Mol Biosci. 2025 Apr 7;12:1513660. doi: 10.3389/fmolb.2025.1513660. eCollection 2025. 10.3389/fmolb.2025.1513660 PubMed 40260404