pAAV_EF1a-FLEx(FRT)-stGtACR2:eGFP (soma-targeted)
(Plasmid
#248662)
-
PurposeExpresses a soma-targeted GtACR2 in Flp-expressing cells under the EF1a promoter for neuronal inhibition.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namestGtACR2
-
Alt namestGtACR2
-
SpeciesSynthetic
-
Insert Size (bp)1860
- Promoter EF1a
-
Tags
/ Fusion Proteins
- eGFP (C terminal on insert)
- Kv2.1 (C terminal on insert) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCAAGCCTCAGACAGTGGTT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byaddgene Plasmid #105677
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-6831193/v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_EF1a-FLEx(FRT)-stGtACR2:eGFP (soma-targeted) was a gift from Gordon Fishell (Addgene plasmid # 248662 ; http://n2t.net/addgene:248662 ; RRID:Addgene_248662) -
For your References section:
Feature-specific threat coding in lateral septum guides defensive action. Mazo DLB, Pasqualini AL, Wu SJ, Berger MZC, Reid CM, Brito SI, Qiu S, Levitt P, Anthony TE, Fishell G. Res Sq [Preprint]. 2025 Jun 12:rs.3.rs-6831193. doi: 10.21203/rs.3.rs-6831193/v1. 10.21203/rs.3.rs-6831193/v1 PubMed 40585201