Skip to main content

pEGFP-C1-myo1e
(Plasmid #248918)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248918 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 7800
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo1e
  • Alt name
    Myosin 1e
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3324
  • Entrez Gene
    MYO1E (a.k.a. FSGS6, HuncM-IC, MYO1C)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer GCGAACGCGGGAGCTCTCACCATG
  • 3′ sequencing primer GTGTCGGATCCACGGGCACCTCAGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Matt Tyska, Mooseker lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-myo1e was a gift from Mira Krendel & Mark Mooseker (Addgene plasmid # 248918 ; http://n2t.net/addgene:248918 ; RRID:Addgene_248918)
  • For your References section:

    Myosin 1E interacts with synaptojanin-1 and dynamin and is involved in endocytosis. Krendel M, Osterweil EK, Mooseker MS. FEBS Lett. 2007 Feb 20;581(4):644-50. doi: 10.1016/j.febslet.2007.01.021. Epub 2007 Jan 18. 10.1016/j.febslet.2007.01.021 PubMed 17257598