pMSP1D1_mCherry
(Plasmid
#248922)
-
PurposeBacterial expression of fluorescent membrane scaffold protein MSP1D1 fused to mCherry for nanodisc formation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-28a(+)
-
Backbone manufacturerGenScript
- Backbone size w/o insert (bp) 5369
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMSP1D1_mCherry
-
SpeciesE. coli
-
Insert Size (bp)1350
- Promoter T7 Promoter
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nco1 (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byStephen Sligar (Addgene #20061), and the fluorescent protein sequence was derived from https://www.fpbase.org/protein/mcherry/ (DOI: 10.1038/nbt1037).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Depositor recommends growing plasmid in the E. coli strain BL21 (DE3).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSP1D1_mCherry was a gift from Michael Marty (Addgene plasmid # 248922 ; http://n2t.net/addgene:248922 ; RRID:Addgene_248922)