pMSP1E3D1_sfGFP
(Plasmid
#248927)
-
PurposeBacterial expression of fluorescent membrane scaffold protein MSP1E3D1 fused to sfGFP for nanodisc formation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-28a(+)
-
Backbone manufacturerGenScript
- Backbone size w/o insert (bp) 5369
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMSP1E3D1_sfGFP
-
SpeciesE. coli
-
Insert Size (bp)1557
- Promoter T7 Promoter
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nco1 (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byStephen Sligar (Addgene #20066), and the fluorescent protein sequence was derived from https://www.fpbase.org/protein/superfolder-gfp/ (DOI: 10.1038/nbt1172).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Depositor recommends growing plasmid in the E. coli strain BL21 (DE3) for protein expression.
Please visit https://doi.org/10.64898/2026.04.07.716332 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSP1E3D1_sfGFP was a gift from Michael Marty (Addgene plasmid # 248927 ; http://n2t.net/addgene:248927 ; RRID:Addgene_248927) -
For your References section:
Design of Fluorescent Membrane Scaffold Proteins for Nanodiscs. Cleveland E, Wolf AR, Chen S, Mohona FA, Kailat I, Tran BH, Babu LS, Lin Y-C, Marty MT. bioRxiv 2026.04.07.716332 10.64898/2026.04.07.716332