pTYB1-MeCP2-R255X (pc4735)
(Plasmid
#249082)
-
PurposeBacteria expression plasmid of MeCP2-R255X (aa1-aa254)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249082 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTYB1
-
Backbone manufacturerNEB
- Total vector size (bp) 8209
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMeCP2
-
SpeciesH. sapiens (human)
-
MutationMeCP2-R255X (aa1-aa254)
-
Entrez GeneMECP2 (a.k.a. AUTSX3, MRX16, MRX79, MRXS13, MRXSL, PPMX, RS, RTS, RTT)
- Promoter T7
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTYB1-MeCP2-R255X (pc4735) was a gift from Cristina Cardoso (Addgene plasmid # 249082 ; http://n2t.net/addgene:249082 ; RRID:Addgene_249082) -
For your References section:
MeCP2-induced heterochromatin organization is driven by oligomerization-based liquid-liquid phase separation and restricted by DNA methylation. Zhang H, Romero H, Schmidt A, Gagova K, Qin W, Bertulat B, Lehmkuhl A, Milden M, Eck M, Meckel T, Leonhardt H, Cardoso MC. Nucleus. 2022 Dec;13(1):1-34. doi: 10.1080/19491034.2021.2024691. 10.1080/19491034.2021.2024691 PubMed 35156529