Skip to main content
Addgene
Open Menu

EBOV 4cis
(Plasmid #249332)

Print

Ordering

This material is available to academics and nonprofits only. Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 249332 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pMTK0_043
  • Backbone manufacturer
    Hana El Samad lab (Mammalian Toolkit, Addgene #1000000180)
  • Backbone size w/o insert (bp) 7588
  • Total vector size (bp) 17888
  • Vector type
    Mammalian Expression, Bacterial Expression ; PiggyBac donor vector
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EBOV NP-P2A-VP35-P2A-VP30-P2A-L protein
  • Alt name
    ZEBOV NP-P2A-VP35-P2A-VP30-P2A-L protein
  • Species
    Ebola virus/H.sapiens-tc/COD/1976/Yambuku-Mayinga
  • Insert Size (bp)
    11067
  • Mutation
    the EBOV NP, VP35, and VP30 ORF sequences within the insert are Homo sapiens codon-optimized
  • GenBank ID
    NC_002549.1 Zaire ebolavirus isolate Ebola virus/H.sapiens-tc/COD/1976/Yambuku-Mayinga, complete genome
  • Promoter CAG

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer cctttagtgagggttaatt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The Mammalian Toolkit (gift of Hana El Samad, Addgene Kit #1000000180) parts: MTK0_043b (PiggyBac donor vecctor backbone with A1 insulator sequences removed), MTK1_022 (ConLS-A4 insulator), MTK2_005 (CAG promoter), and MTK4_003 (rglb polyA).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.01.09.632058 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EBOV 4cis was a gift from Amy Kistler (Addgene plasmid # 249332 ; http://n2t.net/addgene:249332 ; RRID:Addgene_249332)
Related items: