EBOV 4cis
(Plasmid
#249332)
-
PurposeIntegration plasmid encoding EBOV essential replication factors (NP, VP35, VP30, and L protein)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249332 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMTK0_043
-
Backbone manufacturerHana El Samad lab (Mammalian Toolkit, Addgene #1000000180)
- Backbone size w/o insert (bp) 7588
- Total vector size (bp) 17888
-
Vector typeMammalian Expression, Bacterial Expression ; PiggyBac donor vector
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEBOV NP-P2A-VP35-P2A-VP30-P2A-L protein
-
Alt nameZEBOV NP-P2A-VP35-P2A-VP30-P2A-L protein
-
SpeciesEbola virus/H.sapiens-tc/COD/1976/Yambuku-Mayinga
-
Insert Size (bp)11067
-
Mutationthe EBOV NP, VP35, and VP30 ORF sequences within the insert are Homo sapiens codon-optimized
-
GenBank IDNC_002549.1 Zaire ebolavirus isolate Ebola virus/H.sapiens-tc/COD/1976/Yambuku-Mayinga, complete genome
- Promoter CAG
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer cctttagtgagggttaatt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Mammalian Toolkit (gift of Hana El Samad, Addgene Kit #1000000180) parts: MTK0_043b (PiggyBac donor vecctor backbone with A1 insulator sequences removed), MTK1_022 (ConLS-A4 insulator), MTK2_005 (CAG promoter), and MTK4_003 (rglb polyA).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.09.632058 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EBOV 4cis was a gift from Amy Kistler (Addgene plasmid # 249332 ; http://n2t.net/addgene:249332 ; RRID:Addgene_249332)