Suntag_dPRDM9_FWA_g4
(Plasmid
#249562)
-
PurposedCas9_dPRDM9 catalytically dead version
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249562 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEG302
- Backbone size w/o insert (bp) 25324
- Total vector size (bp) 26248
-
Vector typePlant Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)EPI300
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePRDM9
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)924
-
MutationG282A (Numbering from the the full length sequence)
-
Entrez GenePrdm9 (a.k.a. Dsbc1, G1-419-29, Meisetz, PRDM9-B, Rcr1, repro7)
- Promoter UBQ10
-
Tags
/ Fusion Proteins
- sfGFP (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer GAGGTCGGACCGGTCGTACGTATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Suntag_dPRDM9_FWA_g4 was a gift from Jake Harris (Addgene plasmid # 249562 ; http://n2t.net/addgene:249562 ; RRID:Addgene_249562) -
For your References section:
CRISPR targeting of H3K4me3 activates gene expression and unlocks centromere-proximal crossover recombination in Arabidopsis. Binenbaum J, Adamkova V, Fryer H, Xu L, Gorringe N, Wlodzimierz P, Burns R, Papikian A, Jacobsen SE, Henderson IR, Harris CJ. Nat Commun. 2025 Oct 31;16(1):9587. doi: 10.1038/s41467-025-65167-3. 10.1038/s41467-025-65167-3 PubMed 41173880