Skip to main content

CMV-miR-31 sponge
(Plasmid #25025)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 25025 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA5-CMV-d2eGFP
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CMV-miR-31 sponge
  • Alt name
    transient miR-31 sponge
  • Insert Size (bp)
    200

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site ApaI (unknown if destroyed)
  • 5′ sequencing primer CMV-d2eGFP-F, TATATCATGGCCGACAAGC
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-miR-31 sponge was a gift from Bob Weinberg (Addgene plasmid # 25025 ; http://n2t.net/addgene:25025 ; RRID:Addgene_25025)
  • For your References section:

    A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507