Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBp-Control Sponge (CXCR4 sponge)
(Plasmid #22744)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 22744 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBABE-puro
  • Backbone manufacturer
    Weinberg lab (Addgene#:1764)
  • Backbone size (bp) 5169
  • Modifications to backbone
    Non-targeting complementary sites (7x in tandem) to serve as a negative control for microRNA sponge-mediated inhibition of specific microRNA function; suitable for stable expression. Note that EGFP is also cloned into this backbone, upstream of the sponge.
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CXCR4 control sponge
  • Alt name
    stable control sponge
  • Insert Size (bp)
    2000

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site ApaI (unknown if destroyed)
  • 5′ sequencing primer pBabe-5
  • 3′ sequencing primer pBabe-3
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Subclond from CMV-CXCR4 control sponge, as described in Ebert et al. (Nature Methods, 2007)

Sequence of sponge: AAGUUUUCAGAAAGCUAACA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBp-Control Sponge (CXCR4 sponge) was a gift from Bob Weinberg (Addgene plasmid # 22744 ; http://n2t.net/addgene:22744 ; RRID:Addgene_22744)
  • For your References section:

    A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507