-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 25036 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMDH1-PGK-GFP 2.0
-
Backbone manufacturerChang-Zheng Chen, Addgene plasmid 11375
- Backbone size w/o insert (bp) 6963
-
Vector typeMammalian Expression, Retroviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemir-9-3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)313
-
Entrez GeneMIR9-3 (a.k.a. MIRN9-3, hsa-mir-9-3, miRNA9-3, mir-9-3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer EGFP-C
- 3′ sequencing primer H1, tcgctatgtgttctgggaaa
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The mir-9-3 gene was PCR-amplified from normal human genomic DNA and cloned into the MDH-PGK-GFP 2.0 retroviral vector. It includes the miR-9 stem-loop and ~100bp flanking sequences on both sides.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MDH1-PGK-GFP-miR9 was a gift from Bob Weinberg (Addgene plasmid # 25036 ; http://n2t.net/addgene:25036 ; RRID:Addgene_25036) -
For your References section:
miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Ma L, Young J, Prabhala H, Pan E, Mestdagh P, Muth D, Teruya-Feldstein J, Reinhardt F, Onder TT, Valastyan S, Westermann F, Speleman F, Vandesompele J, Weinberg RA. Nat Cell Biol. 2010 Mar . 12(3):247-56. 10.1038/ncb2024 PubMed 20173740