pLX304-mito-Lantern
(Plasmid
#250920)
-
PurposeExpresses Lantern fused to the N-terminal 23 amino acid residues of human COX4 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX304
- Backbone size w/o insert (bp) 7650
- Total vector size (bp) 8094
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemito-Lantern
-
SpeciesH. sapiens (human)
-
Insert Size (bp)444
- Promoter CMV
-
Tag
/ Fusion Protein
- COX4 mitochondrial targeting sequence, V5 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGAGGAGAAAATGAAAGCCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-6890342/v1 for ResearchSquare preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX304-mito-Lantern was a gift from Peng Zou (Addgene plasmid # 250920 ; http://n2t.net/addgene:250920 ; RRID:Addgene_250920) -
For your References section:
Directed evolution of a genetically encoded photocatalyst for temporally resolved proximity labeling of subcellular RNAs and proteins. Fang Y, Ren Z, Zheng F, Wang R, Zhao S, Wang W, Li C, Liu-Yang L, Lin C, Zou P. Research Square 2025 [Preprint]. https://doi.org/10.21203/rs.3.rs-6890342/v1 10.21203/rs.3.rs-6890342/v1