pLV-KLF17-CRa2-MS2
(Plasmid
#251118)
-
PurposesgRNA2 for KLF17 activation cloned into lenti sgRNA(MS2)_puro backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251118 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelenti sgRNA(MS2)_puro optimized backbone
-
Backbone manufacturerFeng Zhang (Addgene #73797)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA2 targeting KLF17 promoter
-
gRNA/shRNA sequenceGAAGTGGCTGGCTGTCCGTG
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GeneKLF17 (a.k.a. ZLF393, ZNF393, Zfp393)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-KLF17-CRa2-MS2 was a gift from Ting Zhou (Addgene plasmid # 251118 ; http://n2t.net/addgene:251118 ; RRID:Addgene_251118) -
For your References section:
Leveraging CRISPR activation for rapid assessment of gene editing products in human pluripotent stem cells. Wu Y, Zhong A, Evangelisti A, Sidharta M, Danwei H, Studer L, Zhou T. Stem Cell Reports. 2025 Apr 25:102499. doi: 10.1016/j.stemcr.2025.102499. 10.1016/j.stemcr.2025.102499 PubMed 40345204