CMV_4xmts_HaloTag
(Plasmid
#251345)
-
PurposeMitochondria matrix targeted HaloTag with 4 mitochondria targeting sequences. CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 3980
- Total vector size (bp) 5279
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHaloTag
-
Insert Size (bp)1299
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV_4xmts_HaloTag was a gift from Edward Avezov (Addgene plasmid # 251345 ; http://n2t.net/addgene:251345 ; RRID:Addgene_251345) -
For your References section:
FidlTrack: high-fidelity structure-aware single particle tracking resolves intracellular molecular motion in organelles sensing APP processing. Parutto P, Yuan Y, Davi V, Pons-Lanau R, Ebeling S, Gupta K, Bottanelli F, Garcia-Parajo MF, Campelo F, Kaminski CF, Chambers JE, Nixon-Abell J, Avezov E. Nat Commun. 2026 Feb 11;17(1):2639. doi: 10.1038/s41467-026-69067-y. 10.1038/s41467-026-69067-y PubMed 41672994