pUC19-Blast-P2A-dTAG
(Plasmid
#251478)
-
PurposeThis vector serves as a PCR template to generate donor DNA that is used for knocking-in dTAG for conditional protein degradation.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251478 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2621
- Total vector size (bp) 3518
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedTAG
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTGGTTATGTGTGGGAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAlessandra Ianari, William Sellers, Addgene Plasmid #185775
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-Blast-P2A-dTAG was a gift from Tomoharu Kanie (Addgene plasmid # 251478 ; http://n2t.net/addgene:251478 ; RRID:Addgene_251478) -
For your References section:
A bulk cell heterozygous knock-in strategy for targeted protein degradation. Liu B, Qi C, Kanie T. bioRxiv 2026.05.19.726384 10.64898/2026.05.19.726384
Map uploaded by the depositor.
