pGS1T-PylRSC6a-PylTm15CUA
(Plasmid
#251554)
-
PurposeProduction of engineered aaRS/tRNA pair for C6a incorporation, also suitable for C5a and C7a incorporation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGS1T
-
Backbone manufacturerin-house design and optimization
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePylRS-C6a
-
Alt namePylS-C6a
-
Alt nameC6aRS
-
SpeciesSynthetic
- Promoter Glutamine synthetase promoter (GlnS)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TAAGATCATACGCCGTTATACG
- 3′ sequencing primer AGATCCTCTTCTGAGATG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePylT-m15_CUA
-
Alt namem15-tRNA-Pyl_CUA
- Promoter proK
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GGATTCCTCAAAGCGTAAACAAC
- 3′ sequencing primer ATGGAACGGGTTGGCATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.02.09.636911 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGS1T-PylRSC6a-PylTm15CUA was a gift from Alexandria Deliz Liang (Addgene plasmid # 251554 ; http://n2t.net/addgene:251554 ; RRID:Addgene_251554) -
For your References section:
Hydrophobic tuning with non-canonical amino acids in a copper metalloenzyme. Deliz Liang A. Unpublished 10.1038/s41557-026-02116-7