pET28(+)-SLAC-6xHis
(Plasmid
#251556)
-
PurposeProduction of the small laccase from Streptomyces coelicolor with C-terminal His6 and missing the N-terminal signaling peptide
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251556 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28(+)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameScSLAC-H6
-
Alt nameScSLAC
-
Alt nameScSLAC-His6
-
Alt nameSmall laccase
-
SpeciesStreptomyces coelicolor
-
Insert Size (bp)969
-
MutationRemoved N-terminal signaling peptide; Codon optimized for E. coli
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.02.09.636911 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28(+)-SLAC-6xHis was a gift from Alexandria Deliz Liang (Addgene plasmid # 251556 ; http://n2t.net/addgene:251556 ; RRID:Addgene_251556) -
For your References section:
Hydrophobic tuning with non-canonical amino acids in a copper metalloenzyme. Deliz Liang A. Unpublished 10.1038/s41557-026-02116-7