4929 TRV2-eTnpBc2xSV40nls-reRNA4PDS
(Plasmid
#251822)
-
PurposeEditing Photene desaturase (PDS) genes in Nicotiana benthamiana
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251822 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneT-DNA
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEnhanced variant of ISDra2 eTnpBc with guide targeting NbPDS with HDV at 3' end
-
Alt namereRNA4 guide target: GCTACAATGAAGGAACTAGC
-
SpeciesDeinococcus radiodurans, Nicotiana benthamiana
-
MutationN4Y/R110K/V192L/L222I
-
Tag
/ Fusion Protein
- 2xSV40nls (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Depositing lab recommends using DH10B cells for growth and expression. Please visit https://doi.org/10.64898/2025.12.05.692691 for bioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
4929 TRV2-eTnpBc2xSV40nls-reRNA4PDS was a gift from Savithramma Dinesh-Kumar (Addgene plasmid # 251822 ; http://n2t.net/addgene:251822 ; RRID:Addgene_251822) -
For your References section:
High-efficiency, transgene-free plant genome editing by viral delivery of an engineered TnpB. Nagalakshmi U, Rodriguez JE, Nguyen T, Weissman RF, Thornton BW, Terrace CI, Savage DF, Dinesh-Kumar SP. Nat Plants. 2026 Mar;12(3):503-511. doi: 10.1038/s41477-026-02237-4. Epub 2026 Feb 20. 10.1038/s41477-026-02237-4 PubMed 41720886