Skip to main content

pAJF1120
(Plasmid #252903)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 252903 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAJF326
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP-NBALFA fusion
  • Promoter Tet-inducible promoter
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer GAGATTCGCCGCCCGAAATG
  • 3′ sequencing primer GAACTCCGTTGTAGTGCTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAJF1120 was a gift from Michael Glickman (Addgene plasmid # 252903 ; http://n2t.net/addgene:252903 ; RRID:Addgene_252903)
  • For your References section:

    A split ALFA tag-nanobody system for protein localization and proximity proteomics in mycobacteria. Fay A, Kurland AP, Li Z, Monetti M, Johnson JR, Glickman MS. mBio. 2025 Aug 13;16(8):e0097125. doi: 10.1128/mbio.00971-25. Epub 2025 Jun 27. 10.1128/mbio.00971-25 PubMed 40576343