pAJF1124
(Plasmid
#252904)
-
Purpose3' rpoC(MSMEG_1368)-ALFA for rpoC-ALFA in M. smegmatis via single crossover. Encodes hygromycin-resistance cassette.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAJF229
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3' rpoC(MSMEG_1368)-ALFA
-
Alt nameMSMEG_1368
-
Alt namerpoC
-
SpeciesMycobacterium smegmatis MC2-155
-
Insert Size (bp)604
-
Tag
/ Fusion Protein
- ALFA tag (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CAATTAACCCTCACTAAAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAJF1124 was a gift from Michael Glickman (Addgene plasmid # 252904 ; http://n2t.net/addgene:252904 ; RRID:Addgene_252904) -
For your References section:
A split ALFA tag-nanobody system for protein localization and proximity proteomics in mycobacteria. Fay A, Kurland AP, Li Z, Monetti M, Johnson JR, Glickman MS. mBio. 2025 Aug 13;16(8):e0097125. doi: 10.1128/mbio.00971-25. Epub 2025 Jun 27. 10.1128/mbio.00971-25 PubMed 40576343