pAJF1141
(Plasmid
#252909)
-
PurposeFor constitutive expression of GFP-NBALFA. Contains oriM (mycobacterial origin of replication) and kanamycin-resistance cassette.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252909 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAJF1120
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-NBALFA fusion
- Promoter PgroL
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Other
- 5′ sequencing primer gttggctagtgttaactat
- 3′ sequencing primer CATCACCATCCAACTCGACC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAJF1141 was a gift from Michael Glickman (Addgene plasmid # 252909 ; http://n2t.net/addgene:252909 ; RRID:Addgene_252909) -
For your References section:
A split ALFA tag-nanobody system for protein localization and proximity proteomics in mycobacteria. Fay A, Kurland AP, Li Z, Monetti M, Johnson JR, Glickman MS. mBio. 2025 Aug 13;16(8):e0097125. doi: 10.1128/mbio.00971-25. Epub 2025 Jun 27. 10.1128/mbio.00971-25 PubMed 40576343