CRISPRi sgSOS1-1
(Plasmid
#253092)
-
PurposeCRISPRi single-guide against SOS1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253092 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCRISPRi
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOS1
-
gRNA/shRNA sequenceGGGAAGCTCCAGCGCTACAC
-
SpeciesH. sapiens (human)
-
Entrez GeneSOS1 (a.k.a. GF1, GGF1, GINGF, HGF, NS4, SOS-1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRISPRi sgSOS1-1 was a gift from Harish Vasudevan (Addgene plasmid # 253092 ; http://n2t.net/addgene:253092 ; RRID:Addgene_253092) -
For your References section:
A transcriptomic, proteomic, and functional genetic atlas dissects neurofibromin function in the peripheral nervous system. Vasudevan HN, Arang N, Sacconi Nunez M, Kennedy P, Payne E, Mohabeer S, Chien J, Wright A, Sale MJ, Krogan NJ, Forget A, McCormick F. Proc Natl Acad Sci U S A. 2025 Jul 8;122(27):e2506823122. doi: 10.1073/pnas.2506823122. Epub 2025 Jun 30. 10.1073/pnas.2506823122 PubMed 40587782