Skip to main content

AAV-hSyn1-DIO-optoRet(WT)
(Plasmid #253534)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253534 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV2
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    DIO-optoRET
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2856
  • Promoter hSyn1
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer agtgcaagtgggttttaggaccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hSyn1-DIO-optoRet(WT) was a gift from Won Do Heo (Addgene plasmid # 253534 ; http://n2t.net/addgene:253534 ; RRID:Addgene_253534)
  • For your References section:

    Integrating artificial intelligence and optogenetics for Parkinson's disease diagnosis and therapeutics in male mice. Hyeon B, Shin J, Lee JH, Kim W, Kwon J, Lee H, Kim DG, Kim CY, Choi S, Jeong JW, Kim KS, Lee CJ, Kim D, Heo WD. Nat Commun. 2025 Aug 21;16(1):7797. doi: 10.1038/s41467-025-63025-w. 10.1038/s41467-025-63025-w PubMed 40841722