AAV-hSyn-hA53T
(Plasmid
#253535)
-
Purposeoverexpression of a human mutated form of aSynuclein (A53T)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV2
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehSNCA
-
Alt namehA53T
-
Alt namealpha synuclein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)423
-
MutationA53T
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter hSyn1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer agtgcaagtgggttttaggaccag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hSyn-hA53T was a gift from Won Do Heo (Addgene plasmid # 253535 ; http://n2t.net/addgene:253535 ; RRID:Addgene_253535) -
For your References section:
Integrating artificial intelligence and optogenetics for Parkinson's disease diagnosis and therapeutics in male mice. Hyeon B, Shin J, Lee JH, Kim W, Kwon J, Lee H, Kim DG, Kim CY, Choi S, Jeong JW, Kim KS, Lee CJ, Kim D, Heo WD. Nat Commun. 2025 Aug 21;16(1):7797. doi: 10.1038/s41467-025-63025-w. 10.1038/s41467-025-63025-w PubMed 40841722