pAN29 Phagemid with EG pathway
(Plasmid
#253996)
-
PurposePhagemid for LySE, carrying a metabolic pathway for ethylene glycol assimilation.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253996 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A, phagemid
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 8715
-
Modifications to backbonePhage T7 origin and packaging site.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEG assimilation pathway
-
SpeciesSynthetic
-
Insert Size (bp)7000
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atggcggacacgatgctggcggcgg
- 3′ sequencing primer gacgctcttcgtacaagatgctcat
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAN29 Phagemid with EG pathway was a gift from Julius Fredens (Addgene plasmid # 253996 ; http://n2t.net/addgene:253996 ; RRID:Addgene_253996)