Skip to main content

pAN29 Phagemid with EG pathway
(Plasmid #253996)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253996 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p15A, phagemid
  • Backbone size w/o insert (bp) 2600
  • Total vector size (bp) 8715
  • Modifications to backbone
    Phage T7 origin and packaging site.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EG assimilation pathway
  • Species
    Synthetic
  • Insert Size (bp)
    7000

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atggcggacacgatgctggcggcgg
  • 3′ sequencing primer gacgctcttcgtacaagatgctcat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAN29 Phagemid with EG pathway was a gift from Julius Fredens (Addgene plasmid # 253996 ; http://n2t.net/addgene:253996 ; RRID:Addgene_253996)