Skip to main content

pSJ55 Accessory plasmid with wt T7 DNAP
(Plasmid #253998)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253998 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    ColE1
  • Backbone size w/o insert (bp) 2500
  • Total vector size (bp) 4720
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    T7 DNAP (wt)
  • Species
    Escherichia phage T7
  • Insert Size (bp)
    2207

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taatacgactcactatagggagacc
  • 3′ sequencing primer tcctaattgggcgatttgccactga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSJ55 Accessory plasmid with wt T7 DNAP was a gift from Julius Fredens (Addgene plasmid # 253998 ; http://n2t.net/addgene:253998 ; RRID:Addgene_253998)