pSJ55 Accessory plasmid with wt T7 DNAP
(Plasmid
#253998)
-
PurposeAccessory plasmid for LySE, carrying wt T7 DNAP for propagation of phage T7∆DNAP
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 4720
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT7 DNAP (wt)
-
SpeciesEscherichia phage T7
-
Insert Size (bp)2207
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taatacgactcactatagggagacc
- 3′ sequencing primer tcctaattgggcgatttgccactga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSJ55 Accessory plasmid with wt T7 DNAP was a gift from Julius Fredens (Addgene plasmid # 253998 ; http://n2t.net/addgene:253998 ; RRID:Addgene_253998)
Map uploaded by the depositor.
