pSJ78 Phagemid with tetA
(Plasmid
#254000)
-
PurposePhagemid for LySE, encoding a tetracycline efflux protein for evolution.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A-phagemid
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 3991
-
Modifications to backbonePhage origin and packaging site
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametetA
-
SpeciesE. coli
-
Insert Size (bp)1300
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgatcggcacgtaagaggttccaac
- 3′ sequencing primer atggagccgggccacctcgacctga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSJ78 Phagemid with tetA was a gift from Julius Fredens (Addgene plasmid # 254000 ; http://n2t.net/addgene:254000 ; RRID:Addgene_254000)