Skip to main content

pSJ139 Accessory plasmid with T7 DNAP v9
(Plasmid #254001)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254001 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    ColE1
  • Backbone size w/o insert (bp) 2500
  • Total vector size (bp) 5592
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    T7 DNAP v9
  • Species
    Synthetic; Escherichia phage T7
  • Insert Size (bp)
    3000

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taatacgactcactatagggagacc
  • 3′ sequencing primer agagaacaagatcaagatgctgtaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSJ139 Accessory plasmid with T7 DNAP v9 was a gift from Julius Fredens (Addgene plasmid # 254001 ; http://n2t.net/addgene:254001 ; RRID:Addgene_254001)