HMGA2 shRNA
(Plasmid
#25408)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 25408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPRIME-CMV-GFP-FF3
-
Backbone manufacturerElledge lab, Addgene plasmid 11663
- Backbone size w/o insert (bp) 8509
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehigh mobility group AT-Hook 2
-
Alt nameHMGA2
-
Alt namepygmy
-
Alt nameHmgic
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)97
-
MutationNone
-
GenBank IDNM_010441
-
Entrez GeneHmga2 (a.k.a. 9430083A20Rik, HMGI-C, Hmgic, pg, pygmy)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (unknown if destroyed)
- 3′ cloning site EcoR1 (unknown if destroyed)
- 5′ sequencing primer EGFP-C
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pPRIME-CMV-GFP-FF3 is available from Addgene.
HMGA2 shRNA sequence:
TGCTGTTGACAGTGAGCGATTTGTGGATCTGATAAGCAAGTAGTGAAGCCACAGATGTACTTGCTTATCAGATCCACAAACTGCCTACTGCCTCGGA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HMGA2 shRNA was a gift from Sean Morrison (Addgene plasmid # 25408 ; http://n2t.net/addgene:25408 ; RRID:Addgene_25408) -
For your References section:
Hmga2 promotes neural stem cell self-renewal in young but not old mice by reducing p16Ink4a and p19Arf Expression. Nishino J, Kim I, Chada K, Morrison SJ. Cell. 2008 Oct 17. 135(2):227-39. 10.1016/j.cell.2008.09.017 PubMed 18957199