dCas12f–σE (sigmaE) system, entry vector
(Plasmid
#254272)
-
PurposeEncodes E. coli codon-optimized dCas12f and σE (sigmaE) from Flagellimonas taeanensis driven by constitutive promoters, with BsaI-containing restriction sites for guide RNA cloning
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDF
- Backbone size w/o insert (bp) 3191
- Total vector size (bp) 6024
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namedCas12f
-
SpeciesFlagellimonas taeanensis
-
Insert Size (bp)1098
-
GenBank IDWP_119619048.1
- Promoter J23105
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer AAGGAGGTAAATAATGGGAAAATCAACACTAAAGCACACT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesigma E
-
SpeciesFlagellimonas taeanensis
-
Insert Size (bp)786
-
GenBank IDRIV51358.1
- Promoter J23105
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AGAAGGAGATATACATATGTTATATTCAGATTTTGAATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dCas12f–σE (sigmaE) system, entry vector was a gift from Samuel H. Sternberg (Addgene plasmid # 254272 ; http://n2t.net/addgene:254272 ; RRID:Addgene_254272) -
For your References section:
Exapted CRISPR-Cas12f homologues drive RNA-guided transcription. Hoffmann FT, Wiegand T, Palmieri AI, Glass-Klaiber J, Xiao R, Tang S, Le HC, Meers C, Lampe GD, Chang L, Sternberg SH. Nature. 2026 Mar 4. doi: 10.1038/s41586-026-10166-7. 10.1038/s41586-026-10166-7 PubMed 41781627