Skip to main content

pTJK6 (miR-513a WT OE in pWCC52)
(Plasmid #254385)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254385 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pWCC52
  • Backbone size w/o insert (bp) 8522
  • Total vector size (bp) 8921
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miR-513a-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    400
  • Entrez Gene
    MIR513A1 (a.k.a. MIRN513-1, MIRN513A1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CCACTACCTGAGCACCCAGTCCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTJK6 (miR-513a WT OE in pWCC52) was a gift from Curt Civin (Addgene plasmid # 254385 ; http://n2t.net/addgene:254385 ; RRID:Addgene_254385)
  • For your References section:

    MiR-513a promotes human erythroid differentiation by modulating c-Jun. Kim M, Taylor B, Bolten S, Eberly CL, Abdurahman M, Creed TM, Yang A, Hatchet TL, Dyson T, Gu S, Civin CI, Kingsbury TJ. FEBS Open Bio. 2026 Mar 8. doi: 10.1002/2211-5463.70226. 10.1002/2211-5463.70226 PubMed 41797400