Skip to main content

c-JUN KO in LentiCRISPRv2GFP
(Plasmid #254390)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254390 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiCRISPRv2GFP (Addgene #82416)
  • Backbone size w/o insert (bp) 13129
  • Total vector size (bp) 13136
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA targeting c-JUN
  • gRNA/shRNA sequence
    GTAGCCATAAGGTCCGCTCT
  • Species
    H. sapiens (human)
  • Entrez Gene
    JUN (a.k.a. AP-1, AP1, c-Jun, cJUN, p39)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (Esp3I) (destroyed during cloning)
  • 3′ cloning site BsmBI (Esp3I) (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    c-JUN KO in LentiCRISPRv2GFP was a gift from Curt Civin (Addgene plasmid # 254390 ; http://n2t.net/addgene:254390 ; RRID:Addgene_254390)
  • For your References section:

    MiR-513a promotes human erythroid differentiation by modulating c-Jun. Kim M, Taylor B, Bolten S, Eberly CL, Abdurahman M, Creed TM, Yang A, Hatchet TL, Dyson T, Gu S, Civin CI, Kingsbury TJ. FEBS Open Bio. 2026 Mar 8. doi: 10.1002/2211-5463.70226. 10.1002/2211-5463.70226 PubMed 41797400