c-JUN KO in LentiCRISPRv2GFP
(Plasmid
#254390)
-
PurposeExpress sgRNA targeting human c-JUN
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254390 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiCRISPRv2GFP (Addgene #82416)
- Backbone size w/o insert (bp) 13129
- Total vector size (bp) 13136
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA targeting c-JUN
-
gRNA/shRNA sequenceGTAGCCATAAGGTCCGCTCT
-
SpeciesH. sapiens (human)
-
Entrez GeneJUN (a.k.a. AP-1, AP1, c-Jun, cJUN, p39)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (Esp3I) (destroyed during cloning)
- 3′ cloning site BsmBI (Esp3I) (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
c-JUN KO in LentiCRISPRv2GFP was a gift from Curt Civin (Addgene plasmid # 254390 ; http://n2t.net/addgene:254390 ; RRID:Addgene_254390) -
For your References section:
MiR-513a promotes human erythroid differentiation by modulating c-Jun. Kim M, Taylor B, Bolten S, Eberly CL, Abdurahman M, Creed TM, Yang A, Hatchet TL, Dyson T, Gu S, Civin CI, Kingsbury TJ. FEBS Open Bio. 2026 Mar 8. doi: 10.1002/2211-5463.70226. 10.1002/2211-5463.70226 PubMed 41797400