c-JUN partial 3'UTR (WT) in pmiRGLO Dual-Luciferase
(Plasmid
#254391)
-
PurposeExpress luciferase reporter containing partial human c-JUN 3'UTR (wild type)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254391 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmirGLO Dual-Luciferase miRNA Target Expression Vector
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7350
- Total vector size (bp) 7920
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namec-JUN partial 3'UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)576
-
GenBank ID
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGACTGACCGGCAAGTTGGAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
c-JUN partial 3'UTR (WT) in pmiRGLO Dual-Luciferase was a gift from Curt Civin (Addgene plasmid # 254391 ; http://n2t.net/addgene:254391 ; RRID:Addgene_254391) -
For your References section:
MiR-513a promotes human erythroid differentiation by modulating c-Jun. Kim M, Taylor B, Bolten S, Eberly CL, Abdurahman M, Creed TM, Yang A, Hatchet TL, Dyson T, Gu S, Civin CI, Kingsbury TJ. FEBS Open Bio. 2026 Mar 8. doi: 10.1002/2211-5463.70226. 10.1002/2211-5463.70226 PubMed 41797400