Skip to main content
Addgene
Open Menu

c-JUN partial 3'UTR (WT) in pmiRGLO Dual-Luciferase
(Plasmid #254391)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254391 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pmirGLO Dual-Luciferase miRNA Target Expression Vector
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 7350
  • Total vector size (bp) 7920
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    c-JUN partial 3'UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    576
  • GenBank ID
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGACTGACCGGCAAGTTGGAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    c-JUN partial 3'UTR (WT) in pmiRGLO Dual-Luciferase was a gift from Curt Civin (Addgene plasmid # 254391 ; http://n2t.net/addgene:254391 ; RRID:Addgene_254391)

  • For your References section:

    MiR-513a promotes human erythroid differentiation by modulating c-Jun. Kim M, Taylor B, Bolten S, Eberly CL, Abdurahman M, Creed TM, Yang A, Hatchet TL, Dyson T, Gu S, Civin CI, Kingsbury TJ. FEBS Open Bio. 2026 Mar 8. doi: 10.1002/2211-5463.70226. 10.1002/2211-5463.70226 PubMed 41797400
Related items: