pCambia2300-Aar1-ccdB-NLS2xmCH
(Plasmid
#254406)
-
PurposeDestination vector for bifluorescence complementation. The plasmid carries NLS-mCherry expressed from the Medicago BCP1promoter.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCambia2300
- Total vector size (bp) 14428
-
Vector typePlant Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS 2X mCherry expressed from the BCP1 promoter
- Promoter Mt BCP1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGAGAGGGAGATGTGTTTTTAAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCambia2300-Aar1-ccdB-NLS2xmCH was a gift from Maria Harrison (Addgene plasmid # 254406 ; http://n2t.net/addgene:254406 ; RRID:Addgene_254406) -
For your References section:
Yeast two-hybrid-sequencing and bifluorescence complementation resources for assessing protein-protein interactions in arbuscular mycorrhizal roots: CKL2 as a case study. Ivanov S, Muller LM, Lefevre FM, Harrison MJ. New Phytol. 2026 Feb;249(4):1592-1604. doi: 10.1111/nph.70832. Epub 2025 Dec 23. 10.1111/nph.70832 PubMed 41431834
Map uploaded by the depositor.
