lenti-hygro-sgMETTL1-3
(Plasmid
#254416)
-
PurposeMammalian expression plasmid encoding an sgRNA targeting human METTL1.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelenti-sgRNA hygro
-
Backbone manufacturerBrett Stringer, Addgene plasmid #104991
-
Vector typeLentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMETTL1
-
Alt nameTRMT8
-
Alt nameC12orf1
-
gRNA/shRNA sequenceGGCATATTCTGCTAGCAGGG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneMETTL1 (a.k.a. C12orf1, TRM8, TRMT8, YDL201w)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-hygro-sgMETTL1-3 was a gift from Rui Su (Addgene plasmid # 254416 ; http://n2t.net/addgene:254416 ; RRID:Addgene_254416) -
For your References section:
Targeting the METTL1/m7G axis as a therapeutic strategy in myeloid leukemia. Ren L, Zhang H, Bobileva O, Nai F, Bi H, Baker G, Dong L, Guarin D, Chan A, Hu W, Li W, Leite I, Wang X, Zhang X, Xue M, Wang H, Qin H, Wu X, Ghoda L, Xu L, Zhang B, Li L, Wunderlich M, Mulloy J, Jones C, O'Leary S, Rosen S, Chen C, Heisterkamp N, Perry JJ, Nam Y, Chen J, Li X, Caflisch A, Su R. Blood 2025; 146 (Supplement 1): 2539. doi: 10.1182/blood-2025-2539 10.1182/blood-2025-2539