Skip to main content

lenti-hygro-sgMETTL1-3
(Plasmid #254416)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254416 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lenti-sgRNA hygro
  • Backbone manufacturer
    Brett Stringer, Addgene plasmid #104991
  • Vector type
    Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    METTL1
  • Alt name
    TRMT8
  • Alt name
    C12orf1
  • gRNA/shRNA sequence
    GGCATATTCTGCTAGCAGGG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    METTL1 (a.k.a. C12orf1, TRM8, TRMT8, YDL201w)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti-hygro-sgMETTL1-3 was a gift from Rui Su (Addgene plasmid # 254416 ; http://n2t.net/addgene:254416 ; RRID:Addgene_254416)
  • For your References section:

    Targeting the METTL1/m7G axis as a therapeutic strategy in myeloid leukemia. Ren L, Zhang H, Bobileva O, Nai F, Bi H, Baker G, Dong L, Guarin D, Chan A, Hu W, Li W, Leite I, Wang X, Zhang X, Xue M, Wang H, Qin H, Wu X, Ghoda L, Xu L, Zhang B, Li L, Wunderlich M, Mulloy J, Jones C, O'Leary S, Rosen S, Chen C, Heisterkamp N, Perry JJ, Nam Y, Chen J, Li X, Caflisch A, Su R. Blood 2025; 146 (Supplement 1): 2539. doi: 10.1182/blood-2025-2539 10.1182/blood-2025-2539